Strain Information | |
---|---|
DGRC Number | 105272 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}NP6584 / TM6C, Sb[1] |
Genotype | y* w*; P{w+mW.hs=GawB}NP6584 / TM6C, Sb1 |
Break points/Insertion Site | 78F3 |
Map Viewer | |
Related Genes | eg CycH |
Original Number | 6584 |
Chromosome | 3 |
Comments | FlyBase Insertion: P{GawB}NP6584 NP line. Received from the National Institute of Genetics. |
Balancer | TM6UW23-1 |
Cluster id | 2024 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Lethality | lethal |
Embryonic Expression | sg |
Larval GFP | no larva 091698 |
Larval X-gal | sg |
Adult GFP | internal |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Kain P, Dahanukar A. Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain. Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np01665_0711 |
Strand | Plus |
Insertion Point | 21739231 |
Chromosome Band | 3L |
Flanking Sequence | gatagttttttgnnngantnacggngtganaaacccatnnttgggtactncggaaagcct tcggctatcgacgggaccaccttatgttatttcatcatgATGCAGGGTGTCTGAGTTTCG AATCGGCATAAATTCGCCGGCAGCTGAGCAAGATGTATCCTGTGAGCTCGCAAAAGAGGT CCTGGACATTCGCCAATGAGGGCCAGCTCATGGAGTTCCGCGTGGAGCAGAACAGCAAGT ACATCGAGTCGCACGAGGAGGAGGCGCAGGGTCGCGACCTCAATGAGCACTTTCTCACGT CGGCGGAGGAGCGCCTGTTGCTGAAGCAGTACGAgatcgaagaatacataagagagaacc gtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacat gtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacgg aattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacc tttgttactactctcttccgatgatgatgtcgcacttatttctatgctgtctcaatgtta gaggcatatcagtctccactgacctntntnttnntgggnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnn |